Journal: International Journal of Molecular Sciences

Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

doi: 10.3390/ijms19124017

Figure Lengend Snippet: Detection of DNA fragmentation in wild-type and gpat3-2 anthers using a terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) nick-end labeling (TUNEL) assay. The wild-type and gpat3-2 mutant anthers at stage 8a ( A , B ), stage 8b ( C , D ), stage 9 ( E , F ), late stage 10 ( G , H ), stage 12 ( I , J ), and dehiscence stage ( K , L ). A red signal indicates propidium iodide (PI) staining, while yellow and green fluorescence indicates a TUNEL-positive signal. TUNEL-positive signals detected in the tapetum cells of both wild-type and gpat3-2 anthers are marked by white arrows, while TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells are marked by blue arrows. Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; Ms, microsporocyte; Msp, microspore; Tds, tetrads; T, tapetum. Scale bars = 50 um.

Article Snippet: TUNEL assay was performed using an In Vitro DeadEnd TM Fluorometric TUNEL System, using fluorescein (Promega, Madison, WI 017959, USA) according to the manufacturer’s instructions with some modifications.

Techniques: End Labeling, TUNEL Assay, Mutagenesis, Staining, Fluorescence

Journal: International Journal of Molecular Sciences

Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

doi: 10.3390/ijms19124017

Figure Lengend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p < 0.01.

Article Snippet: TUNEL assay was performed using an In Vitro DeadEnd TM Fluorometric TUNEL System, using fluorescein (Promega, Madison, WI 017959, USA) according to the manufacturer’s instructions with some modifications.

Techniques: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Comparison, Staining, TUNEL Assay